ID: 1000954034_1000954036

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1000954034 1000954036
Species Human (GRCh38) Human (GRCh38)
Location 5:167521052-167521074 5:167521075-167521097
Sequence CCAATAACATGGTCATATGGAAC TGACCATTCTGGAGAGACTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 81} {0: 1, 1: 0, 2: 0, 3: 21, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!