ID: 1001003011_1001003016

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1001003011 1001003016
Species Human (GRCh38) Human (GRCh38)
Location 5:168025539-168025561 5:168025573-168025595
Sequence CCAAGTAGCAAGAAGAAGTTTAA ATGTGGCTACATTGGGAAATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 217} {0: 1, 1: 0, 2: 6, 3: 104, 4: 813}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!