ID: 1001017968_1001017975

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1001017968 1001017975
Species Human (GRCh38) Human (GRCh38)
Location 5:168158615-168158637 5:168158654-168158676
Sequence CCCACAAGATGCCAATAGCACCC ATCAAAAATGTCTCCAGACTGGG
Strand - +
Off-target summary No data {0: 1, 1: 14, 2: 51, 3: 113, 4: 348}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!