ID: 1001052447_1001052453

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1001052447 1001052453
Species Human (GRCh38) Human (GRCh38)
Location 5:168423966-168423988 5:168424010-168424032
Sequence CCGGAGCTGAGTGCCACTCTTTG CGCCCAGGAAAGATACCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 169} {0: 1, 1: 0, 2: 0, 3: 4, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!