ID: 1001084262_1001084268

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1001084262 1001084268
Species Human (GRCh38) Human (GRCh38)
Location 5:168689109-168689131 5:168689135-168689157
Sequence CCCAGGGATCTTGTTAAAATGTG TCTGATTCAGGGAGTCTGGGTGG
Strand - +
Off-target summary {0: 3, 1: 10, 2: 67, 3: 299, 4: 895} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!