ID: 1001085641_1001085644

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1001085641 1001085644
Species Human (GRCh38) Human (GRCh38)
Location 5:168698482-168698504 5:168698501-168698523
Sequence CCAGAAGCCAGGGAGGGACAAGC AAGCAAGGACCCTCCCCTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 349} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!