ID: 1001116910_1001116917

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1001116910 1001116917
Species Human (GRCh38) Human (GRCh38)
Location 5:168947688-168947710 5:168947709-168947731
Sequence CCCACATGCAGGGCCTGAGGCTG TGGATGCAGACCCAAGGGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 32, 4: 341} {0: 1, 1: 0, 2: 0, 3: 28, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!