ID: 1001217880_1001217885

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1001217880 1001217885
Species Human (GRCh38) Human (GRCh38)
Location 5:169872802-169872824 5:169872843-169872865
Sequence CCCTGGGATCTTGGGCAGATCAC AGTTTCCTCATCTGTAAAATGGG
Strand - +
Off-target summary No data {0: 580, 1: 3018, 2: 7778, 3: 13577, 4: 18950}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!