ID: 1001266427_1001266432

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1001266427 1001266432
Species Human (GRCh38) Human (GRCh38)
Location 5:170277790-170277812 5:170277840-170277862
Sequence CCTCATTAGAGCAATGGGATAAA AAGAGGAAAGAGAAGGAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 159} {0: 1, 1: 7, 2: 110, 3: 985, 4: 5732}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!