ID: 1001280134_1001280143

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1001280134 1001280143
Species Human (GRCh38) Human (GRCh38)
Location 5:170380850-170380872 5:170380888-170380910
Sequence CCTCACTGGGCCTTGTAAAATGG TGCCTAGGAGAACTGTCATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 150} {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!