ID: 1001313396_1001313403

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1001313396 1001313403
Species Human (GRCh38) Human (GRCh38)
Location 5:170626824-170626846 5:170626846-170626868
Sequence CCTACTAGGTCTGAGAAATCCCC CTCAGCTTATGAGCCTGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136} {0: 1, 1: 0, 2: 0, 3: 11, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!