ID: 1001347073_1001347082

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1001347073 1001347082
Species Human (GRCh38) Human (GRCh38)
Location 5:170913312-170913334 5:170913342-170913364
Sequence CCAGTTCAAGTTGAAGGCTCTGG GGGTGGGTGAATGCAAATGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 94} {0: 1, 1: 0, 2: 3, 3: 41, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!