ID: 1001349738_1001349743

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1001349738 1001349743
Species Human (GRCh38) Human (GRCh38)
Location 5:170948842-170948864 5:170948862-170948884
Sequence CCAGCATACAGGTAGACAGACAT CATATAGGACCTGGGTGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 141} {0: 1, 1: 0, 2: 0, 3: 22, 4: 338}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!