ID: 1001357420_1001357422

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1001357420 1001357422
Species Human (GRCh38) Human (GRCh38)
Location 5:171042350-171042372 5:171042368-171042390
Sequence CCATATGATAGGAATTTTTCAAC TCAACTCCATGTAATCCTAAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 31, 4: 341} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!