ID: 1001491643_1001491656

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1001491643 1001491656
Species Human (GRCh38) Human (GRCh38)
Location 5:172160175-172160197 5:172160221-172160243
Sequence CCTACAAAATGGCCCCTAGCCAG CCCAGCATTTTGGGAGGCCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 109} {0: 4293, 1: 91194, 2: 212713, 3: 235265, 4: 160325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!