ID: 1001586141_1001586159

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1001586141 1001586159
Species Human (GRCh38) Human (GRCh38)
Location 5:172834773-172834795 5:172834813-172834835
Sequence CCCTCTCCTCCCTCTACTGAGCC CTCAGCTGACAGGTGGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 63, 4: 564} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!