ID: 1001598337_1001598346

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1001598337 1001598346
Species Human (GRCh38) Human (GRCh38)
Location 5:172912882-172912904 5:172912923-172912945
Sequence CCTCAGCCTCCCAAGTAGCTGGG CATGCCCAGCTAATGTTTTGTGG
Strand - +
Off-target summary {0: 89011, 1: 200457, 2: 243521, 3: 257984, 4: 301655} {0: 1, 1: 14, 2: 93, 3: 267, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!