ID: 1001614172_1001614178

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1001614172 1001614178
Species Human (GRCh38) Human (GRCh38)
Location 5:173029095-173029117 5:173029147-173029169
Sequence CCCTGTGGGAGCTGTTTTTCTAT GGTGTATAGTACTGAAGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 276} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!