ID: 1001749309_1001749315

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1001749309 1001749315
Species Human (GRCh38) Human (GRCh38)
Location 5:174116789-174116811 5:174116812-174116834
Sequence CCTCCAGCCTCCTCGCAGCCCTC TCCCAGTCTCAGTCTCCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 69, 4: 783} {0: 1, 1: 0, 2: 1, 3: 21, 4: 280}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!