ID: 1001929200_1001929205

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1001929200 1001929205
Species Human (GRCh38) Human (GRCh38)
Location 5:175660719-175660741 5:175660757-175660779
Sequence CCACGTATCTGAGTGTGCCCTGT TAGACTGAATTGCCTCTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 1, 4: 90} {0: 1, 1: 0, 2: 1, 3: 11, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!