ID: 1001948623_1001948628

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1001948623 1001948628
Species Human (GRCh38) Human (GRCh38)
Location 5:175800347-175800369 5:175800393-175800415
Sequence CCTTGGTGAAGGGAAGTCAGCCA AAAGTCCCCTTGAACCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 22, 4: 171} {0: 1, 1: 0, 2: 10, 3: 106, 4: 1655}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!