ID: 1001989418_1001989424

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1001989418 1001989424
Species Human (GRCh38) Human (GRCh38)
Location 5:176104003-176104025 5:176104045-176104067
Sequence CCGTGCAAGGGGCCTGCTCATGT TGCCGTGGTCAGTGAGTCTGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 3, 3: 18, 4: 175} {0: 1, 1: 1, 2: 0, 3: 12, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!