ID: 1002101450_1002101467

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1002101450 1002101467
Species Human (GRCh38) Human (GRCh38)
Location 5:176860088-176860110 5:176860127-176860149
Sequence CCCCACACGCCCAGCCAGGGACC CCCCGCCAAGAGGCAGGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 336} {0: 1, 1: 0, 2: 0, 3: 11, 4: 205}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!