ID: 1002102061_1002102076

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1002102061 1002102076
Species Human (GRCh38) Human (GRCh38)
Location 5:176862575-176862597 5:176862625-176862647
Sequence CCTGCCCAGTCTGGCCCCTGGCT TGCCCAGCAGAGTGCCACCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 53, 4: 494} {0: 1, 1: 0, 2: 1, 3: 10, 4: 137}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!