ID: 1002173186_1002173188

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1002173186 1002173188
Species Human (GRCh38) Human (GRCh38)
Location 5:177386477-177386499 5:177386490-177386512
Sequence CCGGGCTGGTGGTGGGGATCCTG GGGGATCCTGGTGACCGTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 386} {0: 1, 1: 1, 2: 1, 3: 15, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!