ID: 1002175785_1002175797

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1002175785 1002175797
Species Human (GRCh38) Human (GRCh38)
Location 5:177400378-177400400 5:177400422-177400444
Sequence CCACGCTCAGGCCCGCCTGCAGG GTGAGCACGCCCACCTCCTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 250} {0: 1, 1: 0, 2: 1, 3: 6, 4: 113}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!