ID: 1002193137_1002193148

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1002193137 1002193148
Species Human (GRCh38) Human (GRCh38)
Location 5:177489260-177489282 5:177489303-177489325
Sequence CCCTACTCCTACTCCAGCTGAGA AGTCGCAGCTGAGGCAAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 191} {0: 1, 1: 0, 2: 0, 3: 14, 4: 173}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!