ID: 1002277699_1002277704

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1002277699 1002277704
Species Human (GRCh38) Human (GRCh38)
Location 5:178114207-178114229 5:178114220-178114242
Sequence CCCCCCAGGTAGCTCCGGGACCT TCCGGGACCTCCCGCAGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 116} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!