ID: 1002283900_1002283907

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1002283900 1002283907
Species Human (GRCh38) Human (GRCh38)
Location 5:178149649-178149671 5:178149675-178149697
Sequence CCAGTCGTCCTGCTGCCAGCCCA GCTTCCAGCGGCAGGTGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 244} {0: 2, 1: 1, 2: 3, 3: 20, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!