ID: 1002283900_1002283913

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002283900 1002283913
Species Human (GRCh38) Human (GRCh38)
Location 5:178149649-178149671 5:178149698-178149720
Sequence CCAGTCGTCCTGCTGCCAGCCCA TGCTACCGGAGCCCCTCATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 244} {0: 1, 1: 2, 2: 0, 3: 2, 4: 48}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!