ID: 1002313969_1002313981

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1002313969 1002313981
Species Human (GRCh38) Human (GRCh38)
Location 5:178331540-178331562 5:178331559-178331581
Sequence CCCCAAGGAATCCGCGGCCCTCG CTCGGGGCAGGGTGCGGAGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 552} {0: 1, 1: 0, 2: 3, 3: 41, 4: 474}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!