ID: 1002328909_1002328915

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1002328909 1002328915
Species Human (GRCh38) Human (GRCh38)
Location 5:178428435-178428457 5:178428485-178428507
Sequence CCTTCCTCATTCTGCTGCTCGGA GTCCGGAGTGACTGCCAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 34, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!