ID: 1002347106_1002347120

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002347106 1002347120
Species Human (GRCh38) Human (GRCh38)
Location 5:178555774-178555796 5:178555820-178555842
Sequence CCCTCACCAGTTCCCTGGGATGC ACGGTGGAGGCCGGACCATAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 230} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!