ID: 1002352040_1002352050

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1002352040 1002352050
Species Human (GRCh38) Human (GRCh38)
Location 5:178590127-178590149 5:178590156-178590178
Sequence CCGCCGCCGCCGCCCGCCGCATT CCCCGCGTCGCCGCCGCCACCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 92, 4: 488} {0: 1, 1: 0, 2: 6, 3: 61, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!