ID: 1002411609_1002411615

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002411609 1002411615
Species Human (GRCh38) Human (GRCh38)
Location 5:179083166-179083188 5:179083212-179083234
Sequence CCAAATGGAAAGTGTGATCCTTT ACCTATAAGAGACATTTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 194} {0: 1, 1: 0, 2: 0, 3: 13, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!