ID: 1002417039_1002417052

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1002417039 1002417052
Species Human (GRCh38) Human (GRCh38)
Location 5:179126130-179126152 5:179126172-179126194
Sequence CCTGAAGGCAGAGAGCTCGACGG CCCTGCCCGAGGGTGCAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 86} {0: 1, 1: 0, 2: 4, 3: 24, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!