ID: 1002422114_1002422124

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1002422114 1002422124
Species Human (GRCh38) Human (GRCh38)
Location 5:179154246-179154268 5:179154270-179154292
Sequence CCCACCCCACCCCGATGATAGGA GGTGCCCCATCTTTCCCCAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 124} {0: 1, 1: 0, 2: 1, 3: 17, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!