ID: 1002428824_1002428832

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1002428824 1002428832
Species Human (GRCh38) Human (GRCh38)
Location 5:179191494-179191516 5:179191529-179191551
Sequence CCCCCACACATCATATTCTGCCG CAGTGTGACCTAAGGAAAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 83} {0: 1, 1: 1, 2: 2, 3: 20, 4: 228}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!