ID: 1002433560_1002433567

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1002433560 1002433567
Species Human (GRCh38) Human (GRCh38)
Location 5:179218215-179218237 5:179218246-179218268
Sequence CCAAAGCCTGGAGCACCAGCAGC CAACATGAGGAGCCCCACCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 53, 4: 381} {0: 1, 1: 0, 2: 1, 3: 17, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!