ID: 1002440624_1002440634

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1002440624 1002440634
Species Human (GRCh38) Human (GRCh38)
Location 5:179262563-179262585 5:179262612-179262634
Sequence CCTTCTGCCCCTTGGTCACGCTG CATGTGCTGTTCCCTCTGCCTGG
Strand - +
Off-target summary No data {0: 7, 1: 76, 2: 324, 3: 914, 4: 2143}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!