ID: 1002493914_1002493923

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1002493914 1002493923
Species Human (GRCh38) Human (GRCh38)
Location 5:179599194-179599216 5:179599222-179599244
Sequence CCTCAGGCGGCAGGCAGGAGGAA TCATGGGCCCTGGGAGCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 40, 4: 336} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!