ID: 1002500364_1002500376

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1002500364 1002500376
Species Human (GRCh38) Human (GRCh38)
Location 5:179643851-179643873 5:179643897-179643919
Sequence CCTGGACCCCATGGCTTCAACTC CGGGTTCCAATTGCCCTACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 347} {0: 1, 1: 0, 2: 0, 3: 1, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!