ID: 1002506375_1002506386 |
View in Genome Browser |
Spacer: 9 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1002506375 | 1002506386 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 5:179681970-179681992 | 5:179682002-179682024 |
| Sequence | CCAGGCGCGATGTTTCATGCCTG | GCACTTTGGGAGGGGAAGGTGGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 17, 2: 698, 3: 12492, 4: 74655} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||