ID: 1002523478_1002523489

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1002523478 1002523489
Species Human (GRCh38) Human (GRCh38)
Location 5:179803768-179803790 5:179803806-179803828
Sequence CCCCACGGGCTCCCGCCCACACC TCCCTACACACTGCAGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 328} {0: 1, 1: 1, 2: 2, 3: 24, 4: 308}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!