ID: 1002525570_1002525576

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1002525570 1002525576
Species Human (GRCh38) Human (GRCh38)
Location 5:179813992-179814014 5:179814026-179814048
Sequence CCTAGTACACGAATAAAAATGTC TGGCGTGAGCCTGTAGTCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 126} {0: 2, 1: 86, 2: 702, 3: 1983, 4: 3983}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!