ID: 1002565920_1002565938

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1002565920 1002565938
Species Human (GRCh38) Human (GRCh38)
Location 5:180113019-180113041 5:180113059-180113081
Sequence CCGGGGATGGACGGAGGGACCGG CGGGCTGGACGGAGGGACCGGGG
Strand - +
Off-target summary {0: 9, 1: 8, 2: 10, 3: 14, 4: 159} {0: 3, 1: 5, 2: 14, 3: 31, 4: 244}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!