ID: 1002570808_1002570811

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1002570808 1002570811
Species Human (GRCh38) Human (GRCh38)
Location 5:180138312-180138334 5:180138329-180138351
Sequence CCCACTCAGGGGCAGGCCTCTTC CTCTTCTAGATTCTTCCCCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 160} {0: 1, 1: 0, 2: 3, 3: 16, 4: 176}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!