ID: 1002599917_1002599921

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1002599917 1002599921
Species Human (GRCh38) Human (GRCh38)
Location 5:180348239-180348261 5:180348267-180348289
Sequence CCTCAATGAGGGCTCGTGAAATT GCGTGTGCACGTGTGTGCCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 48} {0: 3, 1: 19, 2: 23, 3: 80, 4: 481}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!