ID: 1002643575_1002643578

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1002643575 1002643578
Species Human (GRCh38) Human (GRCh38)
Location 5:180641872-180641894 5:180641906-180641928
Sequence CCTAGGATGACTGGGAACTACAG CATGGTTAAGAATAAACTGTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 169} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!