ID: 1002685455_1002685466

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1002685455 1002685466
Species Human (GRCh38) Human (GRCh38)
Location 5:181005798-181005820 5:181005846-181005868
Sequence CCCTATATCCAGCATGCGATGTA TTCATATGTCCAGTGTCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 46} {0: 1, 1: 0, 2: 1, 3: 9, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!